|
AncestryByDNA™ - User Manual Please click link to go to manual
What follows is the User Manual for the genomics test you have purchased. To fully understand your results, we recommend that you read this user manual from the beginning to the end. To view your data files you will need the Adobe Acrobat Reader 5.0 Program available free of charge at http://www.adobe.com/products/acrobat/readstep2.html. 1. How the test works? Your DNA was derived from your mother and father, and theirs was derived from their mothers and fathers, and theirs from their parents and so on. You have 23 pairs of chromosomes. Your maternal copy of chromosome 1 could have been passed through your mother from your maternal grandmother OR your maternal grandfather, but which one you received was randomly determined at conception (you could not have received both). Most of the time this chromosome 1 copy that you receive from your mother is actually a chimeric chromosome that includes parts from your grandfather and your grandmother. Recombination is the process by which these chimeric chromosomes are created and occurs at least once on each chromosome every time a new sperm or egg cell is made. As such, although blending does not occur at the level of the gene (the unit of trait expression) our chromosomes are mixed together and so our genomes contain segments of DNA from all of our ancestors. In contrast, the mitochondrial DNA or Y-chromosome test can only provide data on one single lineage of ancestors each generation into the past. For example, 10 generations ago (year 1802 at 20 years per generation), a baby born today has 1024 ancestors. By measuring your ancestral proportions using a genomics method, we are actually measuring the average population affiliations of all of these 1024 ancestors. Since random processes (recombination and independent assortment) at inception determines the mixing and pairings you harbor, two offspring from a set of parents may have different sets of chromosome pairs, and therefore different ancestral proportions even though they were the product of the same male-female union. For example, an employee of our company is a European male who married a Hispanic woman and had three children of mixed descent. Each of the children exhibits their own unique proportionality, which you can see by clicking on case study. If these two had an infinite number of children, the average would correspond to that proportionality exactly between the mother and father, but each child would deviate from this average by a unique and random amount. 2. Statement on Race Part of our mission at DNAPrint® is to work towards the abolition of these misconceptions and the social injustice that result from Racism and Racialization. In this light, we are dedicating considerable internal resources to education regarding the different perspectives (Socio-cultural, Political, and Biological) on race and the meaning of populations in light of genomic science and biomedical research.
3. Understanding BioGeographical Ancestry 4. What the results mean? It is notable that some regions of the world have more complicated histories than other regions making the concept of ancestry more complicated and even tedious. For much of our history as a species, we were more mobile than today. The advent of agriculture, in at least four separate global regions about 10,000 years ago changed this for many people, but did not stop the process of migration. Indeed, the largest migrations in human history started only 500 years ago with the European colonial period, the trade in enslaved West Africans, and the colonization of the New World. However, prior to this time and for millennia people have moved about and particular regions of the world show traces of these migrations back and forth into and out of continental and sub-continental regions. Some examples of such regions are East Africa, North Africa, Central Asia, South Asia, and Insular Southeast Asia. Although these populations are distinct groups today with languages, cuisines and cultures that identify them as such, their genetic makeup reflects the long-term history of migrations from more than one region. 5. Your Genotypes and the genotypes.doc file It so happens that these letters change slowly over time. When our ancestors migrated to establish the founder groups that gave rise to today’s continental population groups, the nature of their sequences at these sites gradually drifted towards one or the other letter. By measuring the frequency of each letter in each of the descendant ancestral groups of these splinter groups, we can construct a sort of genetic map distinguishing each. We have sequenced your DNA at these sites and made an estimate of the proportional extent to which you share identity with each of four major population groups, sub-Saharan African, European, East Asian, and Native American. 6. Interpreting your results-Introduction Your results are expressed in two separate graphical representations. The first we will discuss is the Composite Triangle Plot and the second is the Bar Graph. 7. Your Triangle Plot and the triangle.doc file
In the example above, the red dot is the MLE. We have dropped a line from the Native American vertex to the line below, and this particular line serves as a scale for the percentage of Native American ancestry – from 0% at the base to 100% at the vertex (or tip). In this example, the individual is about 15% Native American (indicated by the hash mark).
In the example above, we have created the scale line for each of the other two vertices. As with the first figure, for each line the point or vertex represents 100%, and the base near the line represents 0%. The arrows show where the circle projects on to each of these lines. In addition to being able to see that the person is of 15% Native American ancestry in the plot above, we can see that the person is of 60% European Ancestry and 25% African ancestry as well. You will notice that the three percentages must add up to 100%. The MLE we have plotted is a statistical estimate, and all statistical estimates have confidence intervals. The MLE tells you what the best estimates of the proportions are, but in reality, there is a small chance that they are something else. The confidence intervals tell you what other values are also likely. In order to know your proportions with 100% confidence, we would have to perform the test for each region of the variable genome, which would make the test very expensive. Since we have not, your results are statistical estimates. We calculate and plot for you all of the estimates that are "2 fold, 5 fold and 10 fold less likely" than the MLE. The way it works is that the MLE is the most likely estimate. Any point within the first contour (inner most ring) is up to "2 fold less likely" than the MLE. The farther from this point, the closer it is to "2 fold less likely". Any point outside the first and within the second is from "2-5 fold less likely" and any point within the last contour, but outside the second contour is from "5-10 fold less likely Any point outside the last contour is AT LEAST "10 fold less likely" and the farther from the MLE, the greater the increase over "10 fold". The greater the number of DNA positions we read, the closer these contour lines come to the MLE point. On the triangle plot, the likelihood (probability) that your true value is represented by a different point other than the MLE decreases as you approach the red dot, where the probability is at its maximum (hence, it is called the Maximum Likelihood Estimate or MLE). We could perform the test so that the contour lines are very close to the MLE, however this would require us to sequence a much larger collection of markers. To keep the test affordable, we limit the survey to a reasonable number of markers that are sufficient for you to know with good confidence what your proportions are. The yellow circle (10 fold contour) is also referred to as the "one-log interval" and is generally taken as a scientific level of confidence. The composite triangle plot is read in the same manner as the equilateral triangle previously reported. The composite triangle holds 4 smaller equilateral triangles or sub-triangles, and the percentages for any point in each of these triangles is read as described above. You have all possible 3-population triangles and you can see the extension of the confidence intervals in all possible dimensions. Each of the four equilateral triangles within the composite triangle is called a sub-triangle and the percentage mixture corresponding to any point within the sub-triangle is determined using the same scaling method described in above for a single triangle plot. The most likely result is plotted in the center sub-triangle of the composite triangle. Any point within the composite triangle represents a mixture percentage for three groups at a time, but the reason for expressing the data in this new triangle is that all possible groups of three can be presented on a 2-dimensional sheet of paper. The MLE is found at the center of the 2-fold confidence interval marked by the black line. Points within each sub-triangle that fall within the black line represent BGA proportions that are from 1.1 to 2 times less likely to be the true value than the MLE (the greater the distance from the MLE the greater the reduced likelihood). Points within each sub-triangle that fall within the black and blue lines represent BGA proportions that are from 2.1 to 5 times less likely to be the true value than the MLE (the greater the distance from the MLE the greater the reduced likelihood). Points within each sub-triangle that fall within the blue and yellow lines represent BGA proportions that are up to 10 times less likely to be the true value than the MLE (the greater the distance from the MLE the greater the reduced likelihood). In the example plot shown here, the individual is 92% European and 8% Native American. For this individual, there is a noticeable indentation in the confidence contours away from the African axis, showing that there is relatively little chance that the individual has African ancestry. The confidence contours in the Native American direction are broader, and indeed this individual has Native American ancestry. The test is "saying" that there is a chance this person has 16% Native American ancestry, or even 0% Native American ancestry, rather than 8% but that its much less likely (at least 10 times less likely) than the 8% Native American answer. There is also fair spread in the East Asian direction for this individual, indicating that it is possible, though less likely, that this person has some level of East Asian heritage.
Print this plot out and fold along the lines such that you connect all three vertices of the composite triangle to make a pyramid. You will notice that the confidence contour space is now symmetrical. In fact, this is always the case. The confidence contour lines are on the surface of the pyramid but they connect through the center of the pyramid to form a 3-dimensional shape, which has symmetry, and you can imagine this connection by looking at your pyramid. Points in the interior of the pyramid are points with 4-population admixture. Points on the surface of the pyramid are points with 3-population admixture. How likely it is that a 3-population or a 4-population point represents the true admixture proportions depends on whether the point falls within the yellow confidence contour, blue confidence contour or black confidence contour, and whether the point is on the surface (3-population) or interior of the pyramid (4-population). In this way, you can imagine the likelihood of a variety of 4-population mixture results. In fact, people who are most likely to be 4-population mixture would have discontinuous regions on the 2-dimensional representation of the pyramid. An example of such a person is shown below:
Click here/image for larger image Other examples of triangle plots: (each of these individuals is mainly European) 8. Your Bar Graph and the bar graph.doc file How is the bar graph generated? The bar graph is made by taking the MLE values from the 3-D triangle plot method (for individuals of polarized ancestry) or from the 4-D algorithm (for individuals of more complex, or even admixture). The confidence ranges are established for each ancestry group by searching the likelihood calculation of all 3-population or 4-population admixture combinations and finding the highest and lowest values for each group that fall within the 2-fold likelihood range (0.3 Log base 10) of the MLE. Example: The bar graph below shows the results for a person of 2-population admixture. This person’s most likely ancestry mix (MLE) is 55% Native American, 45% European. There are confidence ranges extending above and below the tip of each bar. These ranges show the other percentages this person could be, though any percentage is up to 2-times less likely than the percentage indicated by the blue bar. Though this person is most likely to be 55% Native American, 45% European, they could also possibly be 65% Native American, 35% European though it is 2-times less likely than the MLE value of 55% Native American, 45% European. You will notice that there are confidence bars for the East Asian (EA) and African (AF) groups too. Thus, it is possible that this person is 54% Native American, 44% European, 1% East Asian and 1% Western sub-Saharan African, though again, it is significantly less likely than the most likely estimate of 55% Native American, 45% European.
Click here/image for larger image 9. Simple versus complex admixture The bar graph will communicate approximately the same ratios as presented in your composite triangle plot. However, the bar graph provides you a completely different view of your results. For the bar graph, we calculate the likelihood of ancestry affiliation using the triangle plot algorithm and plot the values from your most likely triangle. If the value for another triangle is within a log base 10 (within 10-fold) of the MLE from the best triangle, the level of the 4th group is also plotted in the bar graph. The data is basically the same as presented in the triangle plot. Your most likely estimate, or "answer", is still the set of percentages provided in the results table, and these percentages should be about the same as those provided in the bar graph, but the view provided by the bar graph is different. The reason we provide you with the bar graph is that it may be useful to some customers because:
For example, a person who believes their great-great-grandfather was an
American Indian but who obtained an MLE result on their triangle plot of
100% European with confidence contours that extend towards the Native American
(and/or East Asian) axes only narrowly may find that in the bar graph the
2-fold confidence range is more substantial. This may lend credence to their
hypothesis.
If a 4-D algorithm works best for people of complex admixture then why don’t we simply calculate the 4-population admixture percentages for each customer whether they are of homogeneous, 2-population, 3-population or 4-population admixture? Mainly because the 4-D algorithm is not as robust for individuals with 3-population or simpler admixture; for these individuals the simultaneous consideration of 4 groups produces too much statistical noise that would impact the quality of the results by a couple of percent. We have concluded from internal research and development that when the number of classification groups increases from 3 to 4, a larger number of genetic "markers" is needed to provide results of comparable confidence as evidenced by the comparison of AncestryByDNA™ 2.5 (a 175 marker test) from the previous version of the test, AncestryByDNA™ 2.0 (a 71 marker test). 10. Your Data Table and the results.doc file SAMPLEID : XXXXXXX
The MLE percentages of European, Sub-Saharan African, East Asian, and Native American are shown. In the example above, the person was determined to be 90% European, 10% Native American, and the MLE is plotted at the position of the triangle plot indicated by these proportions. The bar graph would show solid blue bars at 90% for European and 10% Native American. Unlike the table however, the triangle plot and bar graph show the confidence regions around the MLE, which is, as we have mentioned, are very important for properly interpreting your results. The ancestral proportions we report to you are a function of probability, and the MLE is the best estimate. Going back to the triangle, the further from the point estimate on the triangle, the less likely that point represents your true values. The farther from the red dot (the MLE) in any direction, the lower the probability. Therefore, your plot is an estimate rather than a precise fixed number, but it is the most likely estimate based on the data produced from many regions of your genome. Why is it that it is not possible to determine what your proportions are exactly? When drawing conclusions from DNA one must use statistics. To do this without using statistics, we would have to go back in time 200,000 years and keep track of every one of your ancestors since the origin of our species in Africa. Clearly, this is impossible. Since you inherited your DNA from your ancestors, your ancestral proportions are written in your DNA, but this information must be statistically inferred from the DNA sequence. If we measured 1,000 or 10,000 genetic sites in your DNA as opposed to the 200 or so we measure today, your confidence intervals would be smaller but the MLE would probably be very similar (in the triangle plot, the confidence ring would shrink around the MLE point). The costs of measuring more genetic sites can quickly become out of hand making the price to the consumer unrealistic. Thus, in conclusion, the result of our test is your MLE. Though the MLE is a statistical estimate, and there is a small chance your true proportions are slightly different from that of the MLE, the MLE is the best estimate. If you want to keep it simple, simply use this MLE when describing your genetic heritage. An alternative to understanding more in terms of your family’s heritage is to have more persons in your family (parents, grandparents, siblings) take the standard AncestryByDNA™ test. 11. Your Sequences and the sequences.doc file
The sequences are just a few of those that we measure in order to determine your ancestral proportions. For any genetic position we measure, the variant sequence is flanked by invariant sequence (remember, 99.9% of our DNA is identical from person to person!). For example, if we measured whether you have a C or a T at position 25 in the following sequence: GACCTACCATGATAAATTCCTAGG[C/T]GAGGAAGCTACTACACTGAGTTTAT The site we actually sequence is indicated by the [C/T], and all of the other letters represent DNA nucleotides that are invariant. That is to say, they are the same from person to person. Since these invariant nucleotides have no impact on the estimate of your ancestral proportions, there is no reason to measure them. We provide you with this view of your sequences because you can use them to have fun and learn more about genomics at the same time – here is how. The human genome project has spawned the development of myriad DNA databases, and you use the sequences in a search through these databases. We have all paid for the construction of these databases, and they are yours to use freely. Their main function is as a tool for scientists to better understand why it is that certain people are afflicted with diseases or respond to drugs differently. Many of the databases can be reached through the website of our partner, Geospiza Corp. at http://www.geospiza.com/outreach/organelles/index.html. Geospiza operates this site as a community service, and its main function is to help educate the layperson. In addition to searching with your sequences, you can click on links that will help you understand how the databases were constructed, and what information each offers. For a basic slide show introduction to genomics and DNA databases please visit: http://www.geospiza.com/outreach/organelles/mutation/slide1.html To screen your sequences against the human genome, all you need to do is copy and paste your sequences into the database query forms provided through the http://www.ncbi.nlm.nih.gov/ site (which can be accessed through the http://www.geospiza.com/outreach/organelles/index.html site). Click on the "BLAST" selection on the top menu and you have entered the human genome database search engine. Select "Standard nucleotide-nucleotide BLAST", and then simply paste your sequence (one sequence per query) into the Search box and click BLAST! A progress page will appear, and you will need to click the "Format!" Button to see your results. Learn more about the region of the chromosome corresponding to this sequence by clicking on the blue links. 12. The scientific foundation and validation of the test When tested against known pedigrees, the AncestryByDNA™ 2.5 test performs quite well. The data for individual A is presented below. His wife, individual B, is Hispanic and she was determined to be of mostly Native American ancestry but with some European and African heritage. This was also expected based on what we know from anthropological origin of the Hispanics (which were derived from the union of Spanish explorers, Native Americans, and West Africans in Colonial Caribbean and Latin America). Each of the 3 children is plotted roughly half way amongst both parents, as expected. None of the children exhibit East Asian ancestry. The results of the children were consistent with those of the parents, and the MLE’s are accurate estimates when tested against what is known from biographical data. Experiment: AncestryByDNA™ 2.5 Blind trials on samples from families. Summary of Results: Family 1
Family 1: The father is F and mother is M. Both exhibit some Native American admixture (8% and 12%, respectively). Their children, Individual A and S also both exhibit some Native American admixture (7% and 14%, respectively). Due to the law of independent assortment (the test markers span 22 pairs of chromosomes), these results are reasonable. For example, if one of the children measured with 75% Native American, or 20% East- Asian, these results would be unreasonable. Individual A married his wife, who is Mexican and they had three children, C1, C2, C3 Each of these three children have 38%, 38% and 37% Native American ancestry, respectively, with the balance EUROPEAN and African. Again, these results are quite reasonable given the fact that the father was mostly EUROPEAN with slight Native American admixture and the mother was Hispanic, and mostly Native American with EUROPEAN and African admixture. For more information on how MLE’s read for individuals of various mixed populations, please see www.AncestrybyDNA.com (product info section). You will find that the results are in good agreement with what is known from the anthropological history of each population and that all of the evidence we have to date suggests that AncestryByDNA™ test results are highly accurate. 13. Accuracy and Precision - Simulations The question to answer when developing an admixture test is how many AIMs, and what quality of AIMs are required to minimize the incidence of individuals with MLEs of artificial or erroneous admixture. How frequently they are encountered for each group, given a specific battery of AIMs, is best determined through simulations. If we assume that the loci are unlinked (which they have been determined to be) and the mating between individuals of a given population are random, the multi-locus genotype frequencies in each population are determined from the allele frequencies and an equation known as the product rule. Using these allele frequencies, we simulate a population of 100,000 European, East Asian, African and Native American individuals, draw 10,000 from each population and use the 71 and 175 marker AncestryByDNA™ tests (2.0 and 2.5, respectively) to calculate the BGA proportions for each simulated sample selected. With a perfect test, using discretely distributed alleles, each simulated individual would type as 100% affiliation with their own group. In the real world, using markers that are continuously distributed, there is a level of statistical noise. The purpose of the simulations is to define what that level of noise should be expected. Below we show the average percentage affiliations for each type of simulated sample. The total admixture average is the sum of the average admixture percentages (columns) for samples of a particular simulated population (represented in the rows). For example, for the 71-marker test, we calculate the average level of European, East Asian and Native American admixture in simulated Africans to be 0.96%, 0.1% and 0.87%, respectively. AncestryByDNA™ 2.0 (71 AIM's)
AncestryByDNA™ 2.5 (175 AIM’s)
From this table one can see that the average level of artificial admixture using the 71 marker test is about 5% and the level using the 175 marker test is lower, at about 3%. Looking at the European row in the 175-marker table, we can see that the average simulated European sample exhibits 1.5% East Asian ancestry and 1.74% Native American ancestry. This suggests that the average (but of course, not every) real person who is 100% European will show 1.5% East Asian ancestry as statistical noise, and 3.64% non-European admixture in total as statistical noise. Some will show higher levels, and some will show 0%. One can use these values as a guide for interpreting their result. For example, if a European suspects a small amount of NAM admixture using the 175 marker test and obtains a reading of 1%, they can see that the average simulated European has the same level, and so the data does not support (nor refute) the NAM admixture. We can look at the simulation data in another way – by looking at the variation of results in simulated samples. How common is it that a simulated European (or other) individual exhibits 5% or greater African (or other) ancestry? The results are shown below. 71 marker test
175 marker test
We see that the about 2.7% of simulated samples show 15% or greater artificial admixture using the 71 marker test, and that less than 1% of simulated samples show 15% or greater artificial admixture using the 175 marker test. Reading across the European row, for the 175-marker test, we see that .5% of European individuals registered with 15% or greater East Asian admixture. One can use these values also as a guide for interpreting their result. For example, if a European suspects a small amount of NAM admixture using the 175 marker test and obtains a reading of 17%, this table shows that only 1.5% of simulated Europeans exhibited NAM affiliation this high, and so based on the average MLE, there is about a 98.5% chance that this result indicates real NAM admixture (of course this is based on the average MLE, and a customer should also refer to their individualized confidence contours on their triangle plot). We can make tables like this for all of the possible values X>5%, X>10%, X>15% . . . all the way to X>50%. All 40,000 samples were completely affiliated with their own group at levels of 50% or greater. Down to X=5%, we see it is not uncommon for simulated samples to show affiliation with another group at this level of X. From all of these tables, we can compute the rough percentage value necessary to conclude with 95% certainty that partial group affiliation means real affiliation and not statistical noise. The tables below show the threshold of 95% confidence for each type of admixture in simulated individuals of homogeneous ancestry. A reading at or above X (where X is a % value in a cell of this table) means with 95% certainty that the reading is caused by affiliation with that group in the column, as opposed to the alternative, that the individual is really homogeneously affiliated with their group and the partial affiliation is the result of statistical noise. For example, using the 175 marker test, admixture greater than or equal to 10% Native American is required for an individual of polarized (i.e. mainly) European ancestry to conclude with 95% confidence that there really is Native American admixture as opposed to there being none (and no other admixture). Using the 71 marker test, one must see 12.5% NAM affiliation to conclude with 95% confidence that there really is Native American admixture as opposed to there really being none (and no other admixture). Of course, a customer could get a reading of 8% Native American with the 71 marker test, which is below the 12.5% level threshold, and it still be true that there is Native American admixture. Such a person should type other members of their family. If the level of NAM increases going up the family tree, and if the level is above the threshold in some of the ancestors, it is probably a real indication of NAM admixture for the customer, even though the 8% is below the 95% confidence threshold. In fact, 8% falls near the 90% threshold (we don’t show the 90% threshold on the website), not the 95% threshold, meaning that on its own (regardless of values in family members), the 8% is an indicator of NAM ancestry with 90% (not 95%) confidence. Table SIMSUM175 Threshold of affiliation percentages for samples of polarized, binary affiliation, above which results indicate fractional affiliation with a p < 0.05, using the 175-marker admixture test.
Table SIMSUM71 Threshold of affiliation percentages for samples of polarized, binary affiliation, above which results indicate fractional affiliation with a p < 0.05, using the 71 AIM admixture test.
Of course, there is nothing magical about a 95% vs. 90% confidence interval - and one might argue that genealogists rely on much lower levels of confidence considering non-genetic data. The threshold values required to conclude a bona-fide affiliation with 90% certainty are about 2/3rds those shown above Results compared to the expectations of amateur genealogists In 2003, Charles Kerchner established a website through which customers could report their expected (from traditional lines of research) and observed (from AncestryByDNA™ 2.0) admixture proportions along with explanations and comments on the nature of their evidence. The data below was taken from Charles Kerchner’s project as of Jan. 2004, and you can view his site at http://www.dnaprintlog.org/. From a sample of 108 genealogists, we are able to compare the expected and observed ancestry levels and note any interesting trends. As shown in the tables below, the average amateur genealogist expected 6.6% Native American admixture and got 5.1% using the 71-marker test (Table GENEXPOBS). Of all the amateur genealogists, 69% of those expecting Native American ancestry got a value from the 71 marker test that was within 10% of the level they expected (Table ADMIX10). Table GENEXPOBS . The average percentage of fractional BGA affiliation expected by 108 amateur genealogists compared to the average percentage this sample of genealogist actually obtained using the 71 AIM BGA admixture test (AncestryByDNA™ 2.0) Expected versus Observed levels n=108
Table ADMIX10 Precision of MLE against genealogist expectations using the 71 AIM BGA test (AncestryByDNA™ 2.0) Admix value within 10% expected value
Though this shows that the average individual gets what they expected, not shown in these tables is the fact that the standard deviation (avg. difference from expectations) was relatively high, and so there were many individuals that got significantly different results than they expected. Part of the standard deviation is due to the anecdotal nature of some genealogical expectations; scanning over Mr. Kerchner’s site gives you an idea of the differences in quality of the expectations between individuals – some are better than others. Some of the standard deviation is due to the test. Low levels of NAM or EAS admixture were commonly expected – many times at levels not much different from the threshold values shown above, suggesting that the test assigning low levels of EAS/NAM admixture differently than some genealogists expected them to be assigned. Though the simulations do not specifically address individuals with low levels of admixture (they address individuals of homogeneous ancestry), data from our labs show that the data for the former is not much different and that of the latter and that the relatively high standard deviation is not due solely to statistical error inherent to the test – in other words, there may very well be an anthropological, sociological, psychological or other type of explanation. 14. Test Accuracy
Experiment: Repeated estimation from the same samples with AncestryByDNA™ 2.0(ABD). Purpose: To determine how reproducible the results are by measuring the proportions in the same individuals on different occasions. Results:
Summary of Results: 15. Percentages and physical appearance: 16. Better understanding human genetics The U.S. Department of Energy Human Genome Program is an excellent place
to begin the process of understanding Human genetics. Other informative sites:
For further reading, we recommend: The Great Human Diasporas; The History of Diversity and Evolution, by Cavalli-Sforza. It is an informative tool in understanding migration patterns and ancestral evolution. People interested in discussing genealogy from DNA should visit this interactive forum: http://archiver.rootsweb.com/th/index/GENEALOGY-DNA 17. Glossary Ancestry Informative Marker (AIM): AIMs are the subset of genetic markers that are different in allele frequencies across the populations of the world. Most polymorphisms is shared among all populations and for most loci the most common allele is the same in each population. Allele: Alternate sequences for a particular position in the genome. For example, a common variation in the genome is for some forms of the sequence to have Cytosine (C) while other forms have Thymine (T). Thus, since we have two copies of each chromosome, there are three genotypes at this position CC, CT, and TT. Chromosome: The physical units of heredity: long linear strands of DNA. Humans have 22 autosomal chromosome pairs, plus two sex chromosomes, X and Y. Men have two copies of each autosome, 1, 2, …, 22, X, Y. Women have two copies of each chromosome 1, 2, 3, …, 22, X, X. Each person thus has a total of 46 chromosomes. Genomics: The study of the complete compliment of genetic material in a species. Genome: All of the genetic material in a species. The human genome is approximately 3,300,000,000 base pairs in length. Locus (pl. loci): The name for a physical position on the genome. Can either refer to a large region such as a complete gene or a very specific region, like a particular base pair position. Polymorphism: The property of having more than one state or alternate sequence at a particular position. The alternate states are called alleles. Single Nucleotide Polymorphism (SNP; pronounced snip): A precise base pair position where different people are found to vary in sequence. Generally two alternate alleles are found at a particular SNP. At least 2,000,000 SNPs are now known and there may be over 30,000,000 in the human genome.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
